Automated Differential Display Using a Fluorescently Labeled Universal Primer

Abstract

We have modified the automated differential display reverse transcription polymerase chain reaction technique (DDRTPCR) such that a single fluorescently labeled universal primer (d[F]CTCACGGATCCGTCGATTTT) is used in all PCRs together with a selection of arbitrary primers. We term this fluorescent detection procedure FDDRT-PCR. Anchoring primers of general structure dTGGTCTCACGGATCCGTCGA- (T)12 VN (where N can be any deoxynucleoside and V can be any deoxynucleoside other than thymidine) are used for the RT step, and the universal primer together with selected arbitrary primers are then used for the PCR amplification. Advantages of this approach are: (i) the fluorescently labeled universal primer is a constant feature in every PCR, so that changes in banding profile are highly likely to reflect the incorporation of different arbitrary 10-mer primers; (ii) artifacts that result from arbitrary 10-mer to arbitrary 10- mer primer amplifications are not observed by fluoresence detection on an automated gene scanner because such products are not fluorescently labeled; (iii) sample throughput and ease of data handling are increased when compared with the conventional radioactive/ manual approach and (iv) using a single fluorescently labeled primer in all PCRs is highly cost-effective.