Human Genomics (Dec 2023)

Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families

  • Xiuqin Bao,
  • Danqing Qin,
  • Jicheng Wang,
  • Jing Chen,
  • Cuize Yao,
  • Jie Liang,
  • Kailing Liang,
  • Yixia Wang,
  • Yousheng Wang,
  • Li Du,
  • Aihua Yin

DOI
https://doi.org/10.1186/s40246-023-00559-4
Journal volume & issue
Vol. 17, no. 1
pp. 1 – 5

Abstract

Read online

Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Keywords